Namesko-let-7
AccessionMIMAT0009644
SpeciesSaccoglossus kowalevskii
Precursorssko-let-7
Descriptionexperimental
Experiment454 (Wheeler BM 2009)
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family [0]

Seed family - other species [221]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]