Namesme-let-7b
AccessionMIMAT0003953
SpeciesSchmidtea mediterranea
Precursorssme-let-7b
Descriptionexperimental
Experimentcloned (Palakodeti D 2006), Northern (Palakodeti D 2006), 454 (Friedlander MR 2009), Solexa (Friedlander MR 2009)
Sequence
UGAGGUAGAUUGUUGGAUGACU

Seed family [3]

Seed family - other species [218]

Papers [3]

Landgraf expression levels [0]

M2d disease links [0]