Namesme-let-7d
AccessionMIMAT0011225
SpeciesSchmidtea mediterranea
Precursorssme-let-7d
Descriptionexperimental
Experiment454 (Friedlander MR 2009), Solexa (Friedlander MR 2009)
Sequence
AGAGGUAGUGAUUCAAAAAGUU

Seed family [3]

Seed family - other species [218]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]