Namessc-let-7a
AccessionMIMAT0013865
SpeciesSus scrofa
Precursorsssc-let-7a-1, ssc-let-7a-2
Descriptionexperimental
ExperimentSolexa (Nielsen M 2010, Li G 2011), cloned (Cho IS 2010)
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family - other species [215]

Papers [3]

Landgraf expression levels [0]

M2d disease links [0]