Namessc-let-7c
AccessionMIMAT0002151
SpeciesSus scrofa
Precursorsssc-let-7c
Descriptionexperimental
Experiment454 (Reddy AM 2009), Solexa (Nielsen M 2010), cloned (Cho IS 2010)
Sequence
UGAGGUAGUAGGUUGUAUGGUU

Seed family - other species [215]

Papers [4]

Landgraf expression levels [0]

M2d disease links [0]