Namessc-let-7e
AccessionMIMAT0013866
SpeciesSus scrofa
Precursorsssc-let-7e
Descriptionexperimental
ExperimentSolexa (Nielsen M 2010), cloned (Cho IS 2010)
Sequence
UGAGGUAGGAGGUUGUAUAGUU

Seed family - other species [215]

Papers [2]

Landgraf expression levels [0]

M2d disease links [0]