Namessc-miR-98
AccessionMIMAT0013905
SpeciesSus scrofa
Precursorsssc-mir-98
Descriptionexperimental
ExperimentSolexa (Nielsen M 2010)
Sequence
UGAGGUAGUAAGUUGUAUUGUU

Seed family - other species [215]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]