Nametca-let-7-5p
AccessionMIMAT0008354
SpeciesTribolium castaneum
Precursorstca-let-7
Descriptionexperimental
ExperimentSOLID (Marco A 2010)
Sequence
UGAGGUAGUAGGUUGUAUAG

Seed family [0]

Seed family - other species [221]

Papers [2]

Landgraf expression levels [0]

M2d disease links [0]