Nametgu-let-7f
AccessionMIMAT0014530
SpeciesTaeniopygia guttata
Precursorstgu-let-7f
Descriptionexperimental
Experiment454 (Warren WC 2010), Solexa (Warren WC 2010)
Sequence
UGAGGUAGUAGAUUGUAUAGUU

Seed family - other species [214]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]