Nametni-let-7a
AccessionMIMAT0002929
SpeciesTetraodon nigroviridis
Precursorstni-let-7a-3, tni-let-7a-2, tni-let-7a-1
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family - other species [214]

Landgraf expression levels [0]

M2d disease links [0]