Nametni-let-7d
AccessionMIMAT0002996
SpeciesTetraodon nigroviridis
Precursorstni-let-7d
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUUGGUUGUAUGGUU

Seed family - other species [214]

Landgraf expression levels [0]

M2d disease links [0]