Nametni-let-7g
AccessionMIMAT0003098
SpeciesTetraodon nigroviridis
Precursorstni-let-7g
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGUUUGUAUAGUU

Seed family - other species [214]

Landgraf expression levels [0]

M2d disease links [0]