Nametni-let-7i
AccessionMIMAT0002978
SpeciesTetraodon nigroviridis
Precursorstni-let-7i
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGUUUGUGCUGUU

Seed family - other species [214]

Landgraf expression levels [0]

M2d disease links [0]