Nametni-let-7j
AccessionMIMAT0003014
SpeciesTetraodon nigroviridis
Precursorstni-let-7j
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUUUUUUGUACAGUU

Seed family - other species [214]

Landgraf expression levels [0]

M2d disease links [0]