Namextr-let-7a
AccessionMIMAT0003667
SpeciesXenopus tropicalis
Precursorsxtr-let-7a
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family - other species [214]

Landgraf expression levels [0]

M2d disease links [0]