Namextr-let-7e
AccessionMIMAT0003666
SpeciesXenopus tropicalis
Precursorsxtr-let-7e-1, xtr-let-7e-2
Descriptionexperimental
ExperimentNorthern (Tang GQ 2008)
Sequence
UGAGGUAGUAGGUUGUUUAGUU

Seed family - other species [214]

Landgraf expression levels [0]

M2d disease links [0]