Namextr-let-7f
AccessionMIMAT0003645
SpeciesXenopus tropicalis
Precursorsxtr-let-7f
Descriptionexperimental
ExperimentNorthern (Tang GQ 2008)
Sequence
UGAGGUAGUAGAUUGUAUAGUU

Seed family - other species [214]

Landgraf expression levels [0]

M2d disease links [0]