Namextr-let-7i
AccessionMIMAT0003647
SpeciesXenopus tropicalis
Precursorsxtr-let-7i
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGUUUGUGCUGU

Seed family - other species [214]

Landgraf expression levels [0]

M2d disease links [0]