Namextr-miR-98
AccessionMIMAT0003581
SpeciesXenopus tropicalis
Precursorsxtr-mir-98
Descriptionexperimental
ExperimentNorthern (Tang GQ 2008)
Sequence
UGAGGUAGUAAGUUGUAUUGUU

Seed family - other species [214]

Landgraf expression levels [0]

M2d disease links [0]