Nameaae-mir-124
AccessionMI0013488
SpeciesAedes aegypti
DescriptionAedes aegypti miR-124 stem-loop
CommentThis miRNA was identified independently in Aedes aegypti (Skalsky RL 2010) and in the closely related Aedes albopictus, for which there was no genome sequence (Li S 2009). The latter reads were therefore also mapped to the Aedes aegypti genome (Li S 2009).
LocusCH477191.1-:1664615-1664690
Sequence
UUUUCUCCUGGUAUCCACUGCCGGCCUAUAUGUCCUAUUUCGGUACUCACAAGAGCG

Mature miRNAs [1]

Genome context [0]

Precursor family [101]