Namehsa-let-7a-1
AccessionMI0000060
SpeciesHomo sapiens
DescriptionHomo sapiens let-7a-1 stem-loop
Commentlet-7a* cloned in (Landgraf P 2007) has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
Locus9+:96938239-96938318
Sequence
UGGGAUUAGGGUCACACCCACCACUGGGAGAUAACUA

Mature miRNAs [2]

Genome context [0]

Precursor family [256]

Papers [9]