Namehsa-let-7a-3
AccessionMI0000062
SpeciesHomo sapiens
DescriptionHomo sapiens let-7a-3 stem-loop
Commentlet-7a* cloned in (Landgraf P 2007) has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
Locus22+:46508629-46508702
Sequence
GGGUGGGGCUCUGCCCUGCUAUGGGAUAACU

Mature miRNAs [2]

Genome context [2]

Precursor family [256]

Papers [9]